| Acinetobacter pittii |
| Accession Number: |
AB626884  |
| Source: |
Japan |
| Journal: |
J. Antimicrob. Chemother. 66 (11), 2480-2483 (2011) |
| Published: |
14-SEP-2011 |
| Title: |
Interspecies dissemination of a novel class 1 integron carrying blaIMP-19 among Acinetobacter species in Japan |
| Authors: |
Yamamoto,M., Nagao,M., Matsumura,Y., Matsushima,A., Ito,Y., Takakura,S., Ichiyama,S. |
| Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In477 |
|
|
Gene:
ttagatgcactaagcacataattgctcacagccaaacta
|
|
|