Escherichia coli |
Accession Number: |
AF205943 |
Source: |
n.m. |
Journal: |
Antimicrob. Agents Chemother. 43 (3), 573-581 (1999) |
Published: |
04-JAN-2001 |
Title: |
Molecular and biochemical characterization of VEB-1, a novel class A extended-spectrum beta-lactamase encoded by an Escherichia coli integron gene |
Authors: |
Poirel,L., Naas,T., Guibert,M., Chaibi,E.B., Labia,R., Nordmann,P. |
Remarks: |
In53; class 1 integrase interruped by insertion sequence IS26 |
|
|
Gene:
cacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcat
|
|
|