| Pseudomonas aeruginosa |
| Accession Number: |
AJ550807  |
| Source: |
n.m. |
| Journal: |
J. Antimicrob. Chemother. 52 (4), 583-590 (2003) |
| Published: |
20-JUL-2003 |
| Title: |
Genetic characterization of a novel metallo-beta-lactamase gene, blaIMP-13, harboured by a novel Tn5051-type transposon disseminating carbapenemase genes in Europe: report from the SENTRY worldwide antimicrobial surveillance programme |
| Authors: |
Toleman,M.A., Biedenbach,D., Bennett,D., Jones,R.N., Walsh,T.R. |
| Remarks: |
Tn402-like transposon |
|
|
Gene:
atgaagaaattatttgttttatgtgtatgcttcttttgtagcattactgccgcaggagcg
|
|
|