| uncultured bacterium |
| Accession Number: |
AM911831  |
| Source: |
marine sediment - Canada:Cole Harbour Salt Marsh |
| Journal: |
Environ. Microbiol. 10 (4), 1024-1038 (2008) |
| Published: |
08-JAN-2008 |
| Title: |
Integron-associated gene cassettes in Halifax Harbour: assessment of a mobile gene pool in marine sediments |
| Authors: |
Koenig,J.E., Boucher,Y., Charlebois,R.L., Nesbo,C., Zhaxybayeva,O., Bapteste,E., Spencer,M., Joss,M.J., Stokes,H.W., Doolittle,W.F. |
| Remarks: |
|
|
|
Gene:
ggcgttaggcgttgcgactttctccagcgctatcggtggcatccttggcaggatcgccatgatcatcgcgacaccgttattggcgcgggtggtctaacaat
|
|
|