| Salmonella enterica subsp. enterica serovar Bredeney |
| Accession Number: |
AM932669  |
| Source: |
slaughter swine - Brazil |
| Journal: |
Int. J. Antimicrob. Agents 32 (2), 120-129 (2008) |
| Published: |
18-JAN-2008 |
| Title: |
Molecular analysis of multiresistant porcine Salmonella enterica subsp. enterica serovar Bredeney isolates from Southern Brazil: identification of resistance genes, integrons and a group II intron |
| Authors: |
Michael,G.B., Cardoso,M., Schwarz,S. |
| Remarks: |
|
|
|
Gene:
ggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaa
|
|
|