Escherichia coli |
Accession Number: |
AM932672  |
Source: |
swine, genital tract infection - Germany |
Journal: |
J. Antimicrob. Chemother. 62 (3), 469-473 (2008) |
Published: |
18-JAN-2008 |
Title: |
Analysis and distribution of class 1 and class 2 integrons and associated gene cassettes among Escherichia coli isolates from swine, horses, cats and dogs collected in the BfT-GermVet monitoring study |
Authors: |
Kadlec,K., Schwarz,S. |
Remarks: |
|
|
|
Gene:
ggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaag
|
|
|