| Salmonella enterica subsp. enterica serovar Typhi |
| Accession Number: |
AY245101  |
| Source: |
clinical isolate (stool) - Korea |
| Journal: |
Antimicrob. Agents Chemother. 48 (11), 4130-4135 (2004) |
| Published: |
10-APR-2003 |
| Title: |
Emergence of Multidrug-Resistant Salmonella enterica Serovar Typhi in Korea |
| Authors: |
Lee,K., Yong,D., Yum,J.H., Lim,Y.S., Kim,H.S., Lee,B.K., Chong,Y. |
| Remarks: |
|
|
|
Gene:
atgaaaggctggctttttcttgttatcgcaatagttggcgaagta
|
Protein:
MKGWLFLVIAIVGEV
|
|
|