| Plasmid IncP-1beta pB10-1 |
| Accession Number: |
AY600085  |
| Source: |
wastewater |
| Journal: |
Arch. Microbiol. 182 (6), 429-435 (2004) |
| Published: |
01-SEP-2004 |
| Title: |
Different molecular rearrangements in the integron of the IncP-1 beta resistance plasmid pB10 isolated from a wastewater treatment plant result in elevated beta-lactam resistance levels |
| Authors: |
Szczepanowski,R., Krahn,I., Puhler,A., Schluter,A. |
| Remarks: |
pB10-1; IncP-1beta |
|
Gene:
ggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaag
|
|
|