| Escherichia coli IncW plasmid R388 |
| Accession Number: |
BR000038  |
| Source: |
n.m. |
| Journal: |
Mol. Gen. Genet. 181 (4), 441-447 (1981) |
| Published: |
06-JAN-2006 |
| Title: |
DNA sequence of a plasmid-encoded dihydrofolate reductase; pR388; IncW |
| Authors: |
Swift,G., McCarthy,B.J., Heffron,F. |
| Remarks: |
Class 1 integron. In3 |
| Promoter: |
PcS |
|
|
Gene:
tcaggcttgctcggccgcctctgcgacttcgcgcaccttcggaaaaataatgacgttggtgcggtggggttccat
|
Protein:
MEPHRTNVIIFPKVREVAEAAEQA
|
|
|