Corynebacterium diphtheriae BH8 |
Accession Number: |
CP003209  |
Source: |
n.m. |
Journal: |
Unpublished |
Published: |
10-JAN-2012 |
Title: |
Pan-genomics of Corynebacterium diphtheriae: Insights into the genomic diverstity of pathogenic isolates from cases of classical diphtheria, endocarditis or pneumonia |
Authors: |
Trost,E., Blom,J., Al-Dilaimi,A., Schroeder,J., Soares,S.C., Dorella,F.A., Rocha,F.S., Miyoshi,A., Azevedo,V., Schneider,M.P., Silva,A., Camello,T.C., Sabbadini,P.S., Santos,C.S., Santos,L.S. Jr., Hirata,R., Mattos-Guaraldi,A.L., Efstratiou,A., Schmitt,M.P., Huang,I.-H., Ton-That,H., Tauch,A. |
Remarks: |
Class 1 integrons. This sequence has been manually analyzed by INTEGRALL. In0 (both) |
|
|
Gene:
ttaggtgaggcacgtcgcccagtggacataagcctgttcggttcgtaagctgtaatgcaagtagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacgg
cacagtggcggttttcat
|
|
|