| Salmonella enterica subsp. enterica serovar Typhimurium |
| Accession Number: |
DQ388126  |
| Source: |
clinical isolate; horse - The Netherlands |
| Journal: |
(er) J. Antimicrob. Chemother. 59 (4), 594-599 (2007) |
| Published: |
01-MAR-2006 |
| Title: |
A novel Salmonella genomic island 1 and rare integron types in Salmonella Typhimurium isolates from horses in The Netherlands |
| Authors: |
Vo,A.T., van Duijkeren,E., Fluit,A.C., Gaastra,W. |
| Remarks: |
|
|
|
Gene:
tggcagttgagttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaag
|
|
|