| 
										
						| Psychrobacter sp. |  
						| 
								
									| Accession Number: | FJ469574  |  
									| Source: | agricultural soil amended with tylsoin fed pig slurry and the antibiotics SCP and OTC - United Kingdom |  
									| Journal: | Unpublished |  
									| Published: | 18-FEB-2009 |  
									| Title: | Class 1 and class 2 integrons in bacteria isolated from manured UK agricultural soil |  
									| Authors: | Byrne-Bailey,K.G., Gaze,W.H., Kay,P., Boxall,A., Hawkey,P.M., Wellington,E.M.H. |  
									| Remarks: |  |  |  
						|     |  
							| 
									
																											
										| Gene: 
 atgcgcgatctgttgaaggtggttctaagcctcgtacttgccgatggcatcaa |  
                                                                                | Protein: 
 MRDLLKVVLSLVLADGI |  |  |