| Klebsiella pneumoniae |
| Accession Number: |
FN396877  |
| Source: |
Sweden:Orebro |
| Journal: |
Unpublished |
| Published: |
02-AUG-2009 |
| Title: |
Characterization of a new metallo-beta-lactamase gene, blaNDM-1, carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India |
| Authors: |
Yong,D., Toleman,M.A., Giske,C., Cho,H.S., Lee,K., Walsh,T.R. |
| Remarks: |
pKpANDM-1 |
|
|
Gene:
cgatgcgctcacgcactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcat
|
Protein:
MKTATAPLPPLRSVKVLDQCVSAS
|
|
|