| Escherichia coli |
| Accession Number: |
FR851303  |
| Source: |
n.m. |
| Journal: |
Unpublished |
| Published: |
10-JAN-2012 |
| Title: |
New insights into the fitness-associated mechanisms of ExPECs revealed by the genotypic and phenotypic characterization of large plasmids of APEC 7122 (O78:K80:H9) |
| Authors: |
Mellata,M., Maddux,J., Nam,T., Thomson,N., Hauser,H., Stevens,N.P., Mukhopadhyay,S., Nickerson,C., Sarker,S., Crabbe,A., Curtis III,R. |
| Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In127 |
|
|
Gene:
ttagatttcgagttctaggcgttctgcgatgaaggttggatcccagccgggattgaaagtgtcgacgtgggtgaatccgagccgctcgtataggccacgcaggttcgggtggcagtcgag
ccgcagcttggcgcacccctgcgttcgcgcggcatggcggcaagcctcgatcagcgcggagctgacaccccggcccgcatgtgtccgtcgcaccgcgagcttgtgcagatatgcggcctc
ccccttgagggcgtcgggccagaactcgggatcctcggccgacaaggtgcaacagccgacgatgccgtcgctgcaactcgcgactaggagctcggatctcaggacgaaggtctccgcgaa
tgtccggtcgatccgcgcgacgtcccaggcgggcgttcccttggcggacatccacgccgcagcgtcgtgcatcagccgcacaacctcgtcgatatcacccgagcaggcgacccgaacgtt
cggaggctcctcgctgtccat
|
|
|