Acinetobacter pittii |
Accession Number: |
GQ864268 |
Source: |
Taïwan |
Journal: |
Antimicrob. Agents Chemother. 54 (6), 2699-2703 (2010) |
Published: |
11-OCT-2009 |
Title: |
Molecular characterization of beta-lactamase genes and their genetic structures in Acinetobacter genospecies 3 isolates in Taiwan |
Authors: |
Huang,L.Y., Lu,P.L., Chen,T.L., Chang,F.Y., Fung,C.P., Siu,L.K. |
Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In690 |
|
|
Gene:
ggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaag
|
|
|