Escherichia coli |
Accession Number: |
JF412520 |
Source: |
fish farms - China |
Journal: |
Unpublished |
Published: |
16-JAN-2012 |
Title: |
Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms in Zhongshan, South China |
Authors: |
Su,H.-C. |
Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In155 |
|
|
Gene:
ttagatgcactaagcacatattacacccgg
|
|
|