INTEGRALL

The Integron Database

Acinetobacter baumannii
Accession Number: JF702919
Source: blood
Journal: Submitted (16-MAR-2011) Department of Microbiology, Sri Ramachandra Medical College and Research Institute, Ramachandra Nagar Porur, Chennai, Tamil Nadu 600116, India
Published: 20-JUN-2011
Title: Direct Submission
Authors: Amudhan,S., Sekar,U., Kamalanathan,A., Balaraman,S.
Remarks: Within a class 1 integron according to the authors. This sequence has been manually analyzed by INTEGRALL. Not numbered
Gene:
catggtyyca ttgtccgtga tggtgatgag ttgcttttga ttgatacagc gtggggtgcgaaaaacacag cggcacttct cgcggagatt gagaagcaaa ttggacttcct
gtaacgcgtgcagtctcca cgcactttca tgacgaccgc gtcggcggcg ttgatgtcct tcgggcggctggggtggcra cgtacgcatc accgtcgaca cgccggctag cc
gaggtaga ggggaacgagattcccacsc actctctaga aggactctca tcragcgggg acgcagtgcg cttcggtccagtagaactct tctatcctgg kgctgcgcat tcg
accgaca acttagttgt gtacgtcccgtctgcgagtg tgctctatgg tggttgtgcs atttatgagt tgtcac