| Providencia stuartii |
| Accession Number: |
JN193567  |
| Source: |
Tunisia |
| Journal: |
Antimicrob. Agents Chemother. (2011) |
| Published: |
21-DEC-2011 |
| Title: |
Evolution of an Incompatibility Group IncA/C Plasmid Harboring blaCMY-16 and qnrA6 Genes and its transfer through three clones of Providencia stuartii during a 2-year Outbreak in a Tunisian Burn Unit |
| Authors: |
Arpin,C., Thabet,L., Yassine,H., Messadi,A., Boukadida,J., Dubois,V., Coulange-Mayonnove,L., Andre,C., Quentin,C. |
| Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In633 |
|
|
Gene:
ggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaag
|
|
|