Providencia stuartii |
Accession Number: |
JN193568  |
Source: |
Tunisia |
Journal: |
Antimicrob. Agents Chemother. (2011) |
Published: |
21-DEC-2011 |
Title: |
Evolution of an Incompatibility Group IncA/C Plasmid Harboring blaCMY-16 and qnrA6 Genes and its transfer through three clones of Providencia stuartii during a 2-year Outbreak in a Tunisian Burn Unit |
Authors: |
Arpin,C., Thabet,L., Yassine,H., Messadi,A., Boukadida,J., Dubois,V., Coulange-Mayonnove,L., Andre,C., Quentin,C. |
Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In48 |
|
|
Gene:
ttagatgcactaagcacataattgctcacagccaaactatcaggtcaagtctgcttttattatttttaagcgtgcataa
|
|
|