| Escherichia coli |
| Accession Number: |
JN412067  |
| Source: |
clinical sample - Spain |
| Journal: |
J. Antimicrob. Chemother. (2012) In press |
| Published: |
04-DEC-2011 |
| Title: |
qnr, aac(6')-Ib-cr and qepA genes in Escherichia coli and Klebsiella spp.: genetic environments and plasmid and chromosomal location |
| Authors: |
Ruiz,E., Saenz,Y., Zarazaga,M., Rocha-Gracia,R., Martinez-Martinez,L., Arlet,G., Torres,C. |
| Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In662 |
|
|
Gene:
caagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcaggcagcagggcagtcgccctaaaacaaag
|
|
|