Escherichia coli |
Accession Number: |
JN412067 |
Source: |
clinical sample - Spain |
Journal: |
J. Antimicrob. Chemother. (2012) In press |
Published: |
04-DEC-2011 |
Title: |
qnr, aac(6')-Ib-cr and qepA genes in Escherichia coli and Klebsiella spp.: genetic environments and plasmid and chromosomal location |
Authors: |
Ruiz,E., Saenz,Y., Zarazaga,M., Rocha-Gracia,R., Martinez-Martinez,L., Arlet,G., Torres,C. |
Remarks: |
Class 1 integron. This sequence has been manually analyzed by INTEGRALL. In662 |
|
|
Gene:
caagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatggagcagcaacgatgttacgcaggcagcagggcagtcgccctaaaacaaag
|
|
|