| uncultured bacterium |
| Accession Number: |
JN588530  |
| Source: |
sewage from Jiangxinzhou Sewage Treatment Plant - China: Nanjing |
| Journal: |
Unpublished |
| Published: |
11-JAN-2012 |
| Title: |
Occurrence, abundance and diversity of ARG related mobile genetic elements in sewage treatment plants |
| Authors: |
Zhang,X.-X., Ma,L.-P. |
| Remarks: |
Class 1 integron according to the authors. This sequence has been manually analyzed by INTEGRALL. Not numbered |
|
|
Gene:
ttagatgcactaagcacataattgctcacagccaaactatcaggtcaagtctgctt
|
|
|