uncultured bacterium |
Accession Number: |
JN588530 |
Source: |
sewage from Jiangxinzhou Sewage Treatment Plant - China: Nanjing |
Journal: |
Unpublished |
Published: |
11-JAN-2012 |
Title: |
Occurrence, abundance and diversity of ARG related mobile genetic elements in sewage treatment plants |
Authors: |
Zhang,X.-X., Ma,L.-P. |
Remarks: |
Class 1 integron according to the authors. This sequence has been manually analyzed by INTEGRALL. Not numbered |
|
|
Gene:
ttagatgcactaagcacataattgctcacagccaaactatcaggtcaagtctgctt
|
|
|